AWK est un langage de programmation interprété (AWK signifie Aho, Weinberger, Kernighan) conçu pour le traitement de texte et généralement utilisé comme outil d'extraction de données et de rapport. AWK est largement utilisé avec les systèmes Unix.

awk...

Dans un petit script bash, j'essaie simplement de découper les données d'entrée GPS afin d'avoir des valeurs de longitude et de latitude dans des variables séparées: echo $geo_data GPS_latitude=$( echo $geo_data | awk -F"+|-" '{print substr($0,index($0,$2-1),1) $2}' ) GPS_longitude=$( echo $ge....
31 mai 2020 à 17:11
J'essaie d'extraire trois colonnes d'un fichier texte qui ressemble à ceci: <Record type="HKQuantityTypeIdentifierHeartRate" sourceName="Michael’s Apple Watch" sourceVersion="6.2.5" device="&lt;&lt;HKDevice: 0x2877dc870&gt;, name:WHOOP 3A020013, manufacturer:WHOOP Inc., localIdentifier:80A56B86-0DEC....
30 mai 2020 à 21:19
J'ai un grand ensemble de données TXT qui est délimité par | mais il y a un champ qui permet le texte de paragraphe, qui contient des sauts de ligne et des lignes vides. Toutes les lignes qui ne font pas partie du texte du paragraphe commencent par AA|. Lorsque j'essaye d'importer dans R via readr, ....
30 mai 2020 à 17:58
J'ai un CSV avec de nombreuses colonnes et lignes. La colonne 4 contient des chaînes et d'autres non. Lorsque j'essaie de filtrer les doublons, cela supprime ceux que je souhaite conserver. Quand je cours: awk -F ',' '!seen[$4]++' oldfile.csv > newfile.csv Sur 71523180,PRASAD JAMES ANAND, ,#3 ALEX....
30 mai 2020 à 01:28
Il existe un fichier FASTA assembly.fasta contenant les noms de contig et les séquences correspondantes: >contig_1 CCAATACGGGCGCGCAGGCTTTCTATCGCGCGGCCGGCTTCGTCGAGGACGGGCGGCGCA AGGATTACTACCGCAGCGGC >contig_2 ATATAAACCTTATTCATCGTTTTCAGCCTAATTTTCCATTTAACAGGGATGATTTTCGTC AAAATGCTGAGGCTTTACCAAGATTTTCTACC....
28 mai 2020 à 16:59
J'ai un fichier qui ne veut pas gâcher la séquence alors j'essaye de travailler sur mon instruction conditionnelle awk. Si $ 3 a TB (chaîne), supprimez-le et multipliez-le par 1024 et s'il a Go, supprimez-le simplement (supprimez la chaîne GB) et ne faites rien. sast1sis01_002 iresas-p2-ris....
awk
28 mai 2020 à 15:41
À la fin de la troisième colonne, il y a trois nombres qui commencent par 1.0, comment puis-je imprimer toutes les lignes du début jusqu'à ce que le premier de ces trois nombres (il est en gras ci-dessous) soit trouvé? Existe-t-il une solution simple et unique avec awk ou sed? -80.2743682 -8.642....
28 mai 2020 à 09:05
J'ai ci-dessous un exemple de fichier csv. Besoin de supprimer les derniers mots après .com dans la première colonne (hôte). S'il y a un nombre dans la première colonne (hôte), ce nombre doit être imprimé dans la deuxième colonne (port). Supprimez http // et https: // Le fichier complet fait presque....
27 mai 2020 à 02:58
J'ai un fichier texte et je souhaite afficher des lignes où les 4 premières colonnes apparaissent exactement trois fois dans le fichier. chr1 1 A T sample1 chr1 3 G C sample1 chr2 1 G C sample1 chr2 2 T A sample1 chr3 4 T A sample1 chr1 1 A T sam....
27 mai 2020 à 00:49
J'essaye de convertir toutes les valeurs de la première colonne d'un fichier qui est venu dans l'horodatage de millisecondes à un format de date %Y-%m-%d %H:%M:%S. Mais la sortie est Di 26. Mai 15:04:00 CEST 2020000. J'utilise cette commande: cat throughput-vs-latency-40K-16.csv | sed 's/^/echo "/; ....
26 mai 2020 à 17:57
Chers utilisateurs de stackoverflow, J'ai des données Sep TAB comme ceci: head -4 input.tsv seq A C change seq T A ok seq C C change seq AC CCT change Et j'ai besoin de créer une fonction de complément inverse dans awk qui fait quelque chose comme ça head -4 output.tsv seq T ....
25 mai 2020 à 21:28
J'espère que c'est une solution facile J'ai initialement écrit un script propre et facile qui utilisait gawk, je l'ai utilisé avant tout parce que lorsque je résolvais le problème d'origine, c'était ce que j'ai trouvé. Je dois maintenant l'adapter pour n'utiliser que awk. Exemple de fichier.fasta: >....
25 mai 2020 à 14:47
J'ai deux répertoires. Dans directory_v1, j'ai de nombreux fichiers .text Le contenu de ces fichiers (par exemple file1.txt) est une liste de caractères file1.txt -- rer_098 dfrkk9 Dans le répertoire_2, j'ai de nombreux fichiers, dont deux sont «rer_098» et «dfrkk9». Le contenu de ces fichiers es....
25 mai 2020 à 04:25
Un fichier d'entrée ressemble à ab 1 2 xy 3 5 Quand j'utilise les lignes suivantes dans une boucle NAME=`echo $line | awk '{print $1}'` echo $NAME "-" La sortie est ab - xy - Je ne sais pas si cet "espace" entre le mot et '-' est causé par awk ou écho. Je veux supprimer cela. Je veux être sûr que....
awk
23 mai 2020 à 22:26
J'ai un fichier avec une mauvaise structure, que je convertis en la bonne structure en utilisant une boucle while..read userid1:john doe smith:group1 userid2:jane doe smith:group2 userid3:paul rudd :group2 Code jusqu'à présent: while IFS=: read userid username; do userid=`echo $username|cu....
23 mai 2020 à 20:18
Peut-être que je suis trop vieux pour perl / awk / sed, trop jeune pour arrêter la programmation. Voici le problème que je dois résoudre: J'ai des informations comme celle-ci dans un fichier TXT: Name: Name 1 Phone: 1111111 Email: some@email1 DoentMatterInfo1: whatever1 = Name: Name 2 Phone: 2222222....
22 mai 2020 à 22:41
Le plus simple est de donner un exemple. bash-$ psql -c 'select relname, reltype from pg_catalog.pg_class limit 5; relname | reltype ------------------------+--------- bme_reltag_02 | 0 bme_reltag_type1_type2 | 0 bme_reltag_10 | 0 bme_reltag_....
22 mai 2020 à 02:18
J'ai un programme qui imprime pour stdout certaines données dans le format suivant: $ ./my_program foo line1 line2 line3 bar line1 foo line1 line2 baz line1 line2 Je veux le filtrer, de sorte qu'il n'imprime que des ensembles de lignes non vides commençant par une chaîne correspondante. Quelque ....
21 mai 2020 à 14:33
J'ai un fichier où il se compose de plusieurs lignes comme ci-dessous: part1 { CORE_LK0 } -group { LK0_GROUP } -module { 20rx } Ignore no3 { CORE_ft0 } -sync { n7 } J'ai besoin d'extraire le texte dans la première occurrence de {}. J'ai essayé ceci: grep "{.*}" file.txt Ma sortie: part1 { CORE....
20 mai 2020 à 15:08
J'ai une commande qui affiche plusieurs colonnes comme l'exemple ci-dessous. J'utilise awk pour imprimer $2, $8 et $10. Cependant, une partie d'une colonne est parfois vide, en particulier $9, ce qui rend difficile l'affichage de la sortie requise. 165 sacwbg01_02_002 0 io_grp5 online 1 X3P_MAS01 60....
awk
20 mai 2020 à 14:57
J'utilise find pour rechercher un fichier. alors je passe ce fichier comme argument pour grep. Je veux exécuter le script awk sur chaque résultat? Comment puis-je faire ceci ? Disons donc, find renvoie 5 fichiers, grep sur chaque fichier retourne 15 lignes et sur ces 15 lignes, je veux exécuter le s....
20 mai 2020 à 02:26
J'ai un fichier comme ci-dessous: h1 a 1 h2 a 1 h1 b 2 h2 b 2 h1 c 3 h2 c 3 h1 c1 3 h2 c1 3 h1 c2 3 h2 c2 3 J'ai besoin d'une sortie comme: 2 a 1 2 b 2 6 c 3 J'ai essayé avec bash, d'une manière ou d'une autre, cela ne me donne pas les résultats escomptés. cat sample.log | awk '{print $2 , $3}' | ....
19 mai 2020 à 20:10
J'ai un scénario où j'ai trois mots dans un fichier appelé demo.txt Mes trois mots sont: pomme, mangue, raisin Je veux écrire une commande linéaire pour vérifier si les trois mots existent dans un fichier, puis afficher la correspondance trouvée avec succès ou afficher la correspondance non trouvée ....
19 mai 2020 à 11:29
Le but Nous cherchons à modifier cette sortie (générée à partir du script basé sur iptables(8) ci-dessous s'exécutant sur Ubuntu 18.04 qui analyse le sortie originale, brute et anonyme iptables -nvL de l'un de nos serveurs): Chain INPUT (policy DROP 2525 packets, 130K bytes) target ....
17 mai 2020 à 03:38
J'essaye de réorganiser file1 qui a été trié par la dernière colonne comme ci-dessous MEL P 20190731 0453 30.599 PUS P 20190731 0453 30.612 MEA P 20190731 0453 30.620 KDT P 20190731 0453 30.639 PAS P 20190731 0453 30.644 BDT P 20190731 0453 30.900 LAB P 20190731 0453 31.046 KLS P 20190731 0453 31.12....
16 mai 2020 à 22:28